Below, draw the resulting DNA after Tn/0 has transposed into it, showing the Tn10 by a rectangle (blunt ended DNA) and the target site duplication clearly indicated by arrows

15. (2 pts) Tn/0 is a cut-and-paste (conservative) transposon. Assume that the target DNA site below is cut by Tn/0 transposase as shown below by arrows 5′ GGACTAGGTTTAGCCTCCACT CCTGATCCAAATCGGAGGTGA Below, draw the resulting DNA after Tn/0 has transposed into it, showing the Tn10 by a rectangle (blunt ended DNA) and the target site duplication clearly indicated by arrows.

The post Below, draw the resulting DNA after Tn/0 has transposed into it, showing the Tn10 by a rectangle (blunt ended DNA) and the target site duplication clearly indicated by arrows appeared first on nursing assignment tutor.
The post Below, draw the resulting DNA after Tn/0 has transposed into it, showing the Tn10 by a rectangle (blunt ended DNA) and the target site duplication clearly indicated by arrows appeared first on nursing writers.

"Looking for a Similar Assignment? Order now and Get a Discount!

"Looking for a Similar Assignment? Order now and Get a Discount!

Feeling Lucky?

Enter your email address to spin the wheel for a chance to win exciting offers.

Scroll to Top